Chem. Senses 25: 541-553,
2000
© Oxford University Press 2000
Chemosensory Proteins from the Proboscis of Mamestra brassicae
INRA, Unité de Phytopharmacie et des Médiateurs Chimiques, Bâtiment A, Route de Saint-Cyr, F-78026 Versailles Cedex, France and 1 Max-Planck-Institut für Verhaltensphysiologie, D-82319 Seewiesen, Germany
Correspondence to be sent to: P. Nagnan-Le Meillour, INRA, UPMC, Bâtiment A, Route de Saint-Cyr, F-78026 Versailles Cedex, France. e-mail: nagnan{at}versailles.inra.fr
| Abstract |
|---|
|
|
|---|
Soluble, low molecular weight proteins were immunodetected in proboscis extracts of Mamestra brassicae males by Western blot, using antibodies raised against the general odorant-binding protein of the moth Antheraea polyphemus. The same antibodies weakly labelled the sensillum lymph and subcuticular space of sensilla styloconica on ultrathin sections of the proboscis. The morphology of sensilla styloconica is described. The immunodetected proteins yielded several N-terminal sequences, three of which showed strong affinity for tritiated analogues of pheromonal compounds of M. brassicae in binding assays. The cDNAs coding for these sequences were cloned and it was shown that the new proteins are related to the OS-D protein of Drosophila. They are named chemosensory proteins (CSP-MbraA1CSP-MbraA5 and CSP-MbraB1 and CSP-MbraB2) and may have an odorant-binding protein-like function. A common localization in both olfaction and taste organs suggests a physiological role depending on the cellular environment.
| Introduction |
|---|
|
|
|---|
Insects perceive the chemical cues of their environment by different chemosensory organs. In particular, the proboscis is important in host recognition for oviposition for females and in food uptake for both sexes. The proboscis consists of two elongated galea which originate on basal maxillary structures. This structure, elastic, deformable and capable of extention and recoil, is a sense organ equipped with chemoreceptors and mechanoreceptors.
The sensilla of the lepidopteran proboscis are usually classified into sensilla trichodea, sensilla basiconica and sensilla styloconica, the latter showing an amazing variety of sizes and shapes (Städler et al., 1974
; Sellier, 1975
; Faucheux, 1991
; Büttiker et al., 1996
; Paulus and Krenn, 1996
). Although the general morphology of the proboscis in Lepidoptera is well known (Eastham and Eassa, 1955
), the function of proboscis sensillar organs of adult Lepidoptera have been investigated in only a few species. Most studies used only scanning or transmission electron microscopy (Krenn, 1998
; Walters et al., 1998
), histology (Städler et al., 1974
) or sometimes electrophysiological recordings (Städler and Seabrook, 1975
) to make functional considerations. Although the proboscis is first thought of as a taste and food uptake organ, some authors found evidences for both gustatory and olfactory functions (Altner and Altner, 1986
). In fact, these authors described sensilla with both a terminal pore and wall pores, which characterize sensilla housing chemoreceptors which react to volatile stimuli, on the proboscis of Rhodogastria bubo. Although no electrophysiological experiments were done on this species to support this hypothesis, Städler and Hanson (Städler and Hanson, 1975
) were able to demonstrate that receptors on the maxillae of Manduca sexta larvea which were classified as contact chemoreceptors due to their structure were responsive to vapours of normal food substances.
The data accumulated on the proboscis establish this organ as a chemosensory organ with an important behavioural role. In this context, we propose exploring the underlying biochemistry by identifying and characterizing proboscis proteins in the cabbage armyworm Mamestra brassicae. In another chemosensory organ, the antenna, we have previously characterized odorant-binding proteins (OBPs) specifically expressed in male and female antennae of this species (Nagnan-Le Meillour et al., 1996
). The genes coding for three OBPs, MbraPBP1, MbraPBP2 and MbraGOBP2, were cloned (Maïbèche-Coisné et al., 1998a
,b
). A binding assay with purified proteins has shown that MbraPBP1 specifically binds a tritiated analogue of the major pheromonal component, cis-11-hexadecenyl acetate (Z1116:Ac), in contrast to MbraPBP2, the specific ligand of which remains unknown (Maïbèche-Coisné et al., 1997
). Differences in the full-length sequences appear to be linked to the binding selectivity of MbraPBP1 and MbraPBP2 (Maïbèche-Coisné et al., 1998b
), supporting the hypothesis of Du and Prestwich (Du and Prestwich, 1995
) that the primary structure encodes the ligand binding specificity in pheromone-binding proteins.
In this paper we report a similar approach which allowed the characterization of soluble proteins from the proboscis of M. brassicae males that could be referred to as a new type of OBPs.
| Materials and methods |
|---|
|
|
|---|
Insects
Mamestra brassicae were reared in Le Domaine du Magneraud (INRA, France) on a semi-artificial diet (Poitout and Bues, 1974
) at 20°C with a 16 h/8 h light/dark photoperiod. Males and females were sexed as pupae.
Antisera
Polyclonal antisera generated against PBP and GOBP2 of Antheraea polyphemus (anti-ApolPBP and anti-ApolGOBP2) (Steinbrecht et al., 1992
, 1995
) were used in immunocytochemistry and immunoblotting.
Pheromone analogues
The synthesis of tritiated analogues of Z1116:Ac (Maïbèche-Coisné et al., 1997
) and of both cis-11-hexadecenol (Z1116:OH) and hexadecanyl acetate (16:Ac) have been previously reported (Bohbot et al., 1998
). The tritiated analogue of cis-11-octadecenyl acetate (vaccenyl acetate, Z1118:Ac) was a gift of Dang Ba Pho (Université Paris XI). The specific activity of tritiated compounds was 1.7 TBq/mmol for [3H]Z1116:Ac, 1.9 TBq/mmol for [3H]Z1116:OH, 0.8 TBq/mmol for [3H]Z1118:Ac and 10.3 TBq/mmol for [3H]16:Ac. For simplicity, the tritiated analogues are refered to as the cold molecules in this paper (e.g. Z1116:Ac refers to [3H]Z1116:Ac).
Morphology and immunocytochemistry
For scanning electron microscopy, proboscis tips were fixed in modified Carnoy, dehydrated and air dried from hexamethyldisilazane (Bock, 1987
). After sputtering in a Bal-Tec SCD 050 sputter coater with 6 nm of platinum, the specimens were studied in a Jeol JSM 6300F scanning electron microscope equipped with a field emission gun.
Excised proboscis tips were fixed on a thin tungsten wire and cryofixed by plunging into super-cooled propane (180°C). Freeze-substitution was done in acetone containing 2% osmium tetroxide for morphology and in acetone containing 3% glutaraldehyde (water-free by molecular sieving) for immunocytochemistry in a home-made substitution apparatus with a programmable temperature/time protocol (Marshall and Kent, 1991
). For morphology, specimens were embedded in Epon, for immunocytochemistry, the acrylic resin LR White (London Resin) was used. For details of specimen preparation see Steinbrecht and co-workers (Steinbrecht, 1993
; Steinbrecht et al., 1995
). Ultrathin sections were cut with a diamond knife on Reichert OMU2 or Ultracut ultramicrotomes and mounted on formvar-coated single hole copper grids.
For immunocytochemistry, the following blocking solutions were used: PBSglycine [50 mM glycine in phosphate-buffered saline (PBS)] and PBGT (PBS containing 0.050.2% gelatin, 0.51% bovine serum albumin and 0.010.1% Tween 20). The primary antisera, anti-ApolPBP and anti-ApolGOBP2, were used diluted 1:500 to 1:3000 in PBGT; the secondary antibody was anti-rabbit IgG coupled to 10 nm colloidal gold (Amersham Buchler, Braunschweig), diluted 1:20 in PBGT. As a control, the primary antiserum was replaced by pre-immune serum at dilutions between 1:100 and 1:1000. The labelling protocol was as described by Steinbrecht et al. (Steinbrecht et al., 1995
). Silver intensification according to Danscher (Danscher, 1981
) for 15 min under reduced daylight enlarged the gold particules to
40 nm for observation at low magnification. Sections were stained for 10 min in 2% uranyl acetate and investigated in a Zeiss EM 10A electron microscope at 60 or 80 kV.
Preparation of samples
Probosces and antennae were cut within 2 days after emergence and stored at 25°C until use. Probosces or antennae were crushed on ice by hand in 1% trifluoroacetic acid (TFA), sonicated for 10 min, then centrifuged (11 000 g for 15 min at 4°C). Supernatants were filtered by centrifugation (Z-spin, 0.2 µm; Gehlman Sciences), then evaporated under vacuum (Savant Speed-Vac) and stored at 70°C until use.
Protein purification
Extracts of 1400 male probosces for each purification were analyzed by reverse phase HPLC (RP-HPLC) in a Varian device (9012 pump, 9100 sampler, 9065 diode array detector). Proteins were separated on a 4.6 x 100 mm Aquapore RP-300 cartridge (Perkin Elmer), in 25 mM ammonium acetate, pH 7.2 (buffer A) and 50 mM ammonium acetate, pH 7.2 (buffer B), using an acetonitrile linear gradient (550% acetonitrile, flow rate 0.8 ml/min). Fractions were collected, lyophilized and analysed either by native-PAGE or by binding assay.
Electrophoresis, Western blot and binding assay
For Western blotting, proteins of total extracts were separated by native-PAGE (14%) then electrotransferred onto Immobilon P membranes, according to the semi-dry blotting procedure of Kyhse-Andersen (Kyhse-Andersen, 1984
). Immobilon membranes were blocked overnight at 4°C with 5% dry milk in TBS/Tween 20 (0.1%), then incubated for 4 h with either anti-ApolPBP serum or anti-ApolGOBP2 serum at a 1:1000 dilution and room temperature. Bound antibodies were detected by goat anti-rabbit IgG coupled to horseradish peroxidase (dilution 1:10 000) for 2 h at room temperature. The signal was revealed using an Enhanced ChemiLuminescence kit (ECL; Amersham) following the manufacturers protocol.
After HPLC, the resulting fractions were analyzed by electrophoresis under native conditions as previously described (Nagnan-Le Meillour et al., 1996
) and the gels stained with a colloidal Coomassie blue R solution (Nagnan-Le Meillour et al., 1996
). For the binding assay, lyophilized crude extracts or purified proteins were resuspended in 15 µl electrophoresis sample buffer, then incubated with 5 µl (1 µCi) of the tritiated analogues of pheromonal compounds for 30 min on ice. The samples were subjected to native electrophoresis and electroblotted overnight (80 mA, constant current) onto ProBlott membranes (Perkin Elmer). The membranes were treated for fluorography (30 min in 7% formaldehyde, 60 min in 1 M salicylic acid), dried at room temperature and exposed to Hyperfilm MP (Amersham) for 6 days. After this first exposure, the membranes were again treated for fluorography and re-exposed for 21 days to enhance the signal. Membranes were stained with Ponceau red (0.2% in 1% acetic acid) in order to precisely associate the radioactivity with the binding protein. These bands were finally excised for N-terminal sequencing. The entire procedure (purification and binding assays) was repeated three times.
N-terminal sequences were obtained by J. dAlayer (Institut Pasteur, France) with a gas phase microsequencer (Applied Biosystems) and reagents and methods as provided by the manufacturer.
Molecular cloning and sequencing
RNA extraction and cDNA synthesis
Total RNA was extracted from 200 probosces of adult males with the Tri-Reagent (Euromedex). Single-stranded cDNA was synthesized from 1 g of total RNA with M-MLV (US Biochemical), using the buffer and protocol supplied with the enzyme. The reaction mixture contained dNTP mix (Pharmacia), RNasin (Promega), oligo(dT)18 with an anchor (CATGCATGCGGCCGCAAGCT18VN, synthesized by Isoprim, Toulouse, France), sterile water and template RNA to a final volume of 50 µl. The mix was heated to 68°C for 5 min and then chilled on ice before adding the M-MLV (600 U), incubated for 1 h at 37°C and finally the reverse transcriptase was inactivated at 95°C for 5 min.
3'-RACEPCR
Approximately 1 ng of cDNA was used for PCR. The sense primers were designed based on protein N-terminal sequences: GAGGACAAGTACACIGAYAAGTACGA for the protein EDKY and GAGGAGGCICAYTAYACIGAYCG for the protein EEAH. Both primers were synthesized by Isoprim. These primers were used in a pair with the primer used for cDNA synthesis [anchoroligo(dT)18] in order to perform the 3'-RACE. PCRs were carried out with Taq polymerase (1 U) (Promega) in 10 mM TrisHCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM each dNTP. Forty amplification cycles were performed with an annealing temperature of 60°C for EDKY and 55°C for EEAH.
Cloning and sequencing
The amplified cDNAs were purified after agarose electrophoresis using GenElute (Supelco) and ligated into the plasmid pCR-II using the TOPO cloning kit from Invitrogen. After transformation, positive clones were digested with EcoRI (Biolabs) to screen for presence of the insert. Recombinant plasmids were then isolated using a Plasmid Midi kit from Qiagen and were subjected to automated sequencing with vector primers (T7 and M13 promoters) by ESGS (Evry, France). For each amplification, several clones were sequenced. Database searches were performed with the BLAST program (NCBI) and sequence alignment with ClustalW (nps@ibcr).
| Results |
|---|
|
|
|---|
Morphology and immunolocalization
The proboscis of M. brassicae follows the general plan of the lepidopteran proboscis consisting of two greatly elongated and interlocked galeae forming the tube-shaped food canal. A variety of sensilla are found, particularly on the distal end of the proboscis, of which the sensilla styloconica are the largest and most conspicuous (Figure 1A). Their mean number per galea is 121 ± 20 (n = 15), with no significant differences between the sexes.
|
The sensilla styloconica consist of a small cone (the sensillum proper) that is located on a long stylus with conspicuous longitudinal ridges (Figure 1B,C). High resolution scanning electron microscopy revealed a complex terminal pore and additional wall pores (Figure 1D,E). Wall pores were also evident on transverse sections through the cone (Figure 3A). Three receptor neurons send their dendrites into the cone where they are surrounded by a dense dendrite sheath up to the terminal pore, while the fourth ends with a tubular body at the base of the cone (Figures 2 and 3A); the receptor cell somata are located below the base of the stylus within the proboscis. Three auxiliary cells are observed: the innermost thecogen cell continues distally with a very dense dendrite sheath surrounding the outer dendritic segments; trichogen and tormogen cells border a large sensillum lymph cavity which apically fills the sensillar cone and extends basally with two deep pouches below the base of the stylus (Figure 2). The wall of the stylus is bordered by two epidermal cells, which are not closely attached to the cuticle but leave a subcuticular space (Figures 2 and 3C); this subcuticular space increases in volume towards the stylus base.
|
|
There are also sensilla basiconica on the proboscis of M. brassicae, which are smaller and more dispersed than the sensilla styloconica. They were encountered too rarely in this study to permit definitive morphological classification.
Labelling with anti-ApolPBP serum was too weak to give a signal different from background anywhere on our sections, suggesting a total absence of PBPs in the proboscis. Upon labelling with anti-ApolGOBP2, gold particles were found in all sensillum lymph compartments of the sensillum, i.e. in the distal peg around the outer dendritic segments inside and outside of the dendrite sheath (Figure 3C) and in the two deep sensillum lymph cavities of the trichogen and tormogen cell at more proximal levels (Figure 3B). In addition to labelling of the sensillum lymph, we also consistently found gold particles in the subcuticular space between epidermal cells and the cuticle of the stylus (Figure 3B,C). However, gold particles at lower density were also found in other tissue compartments, e.g. cuticle, haemolymph, the cytoplasm of dendrites and various cells (Figure 3B). These with all likehood represent non-specific background (see Discussion).
Compared to the labelling of sensilla basiconica of Antheraea polyphemus with anti-ApolGOBP2, which resulted in grain densities of 100 particles/m2 with a serum dilution of 1:9000 (Laue et al., 1994
) (unpublished data), sensilla styloconica on the proboscis of M. brassicae showed on average only 3 ± 1.5 gold particles/m2 (n = 17) at a serum dilution of 1:3000 (Figure 3C). With higher serum concentrations the labelling density increased, but at the same time the background also increased.
Sensilla basiconica were encountered too rarely to decide whether they were specifically labelled. No compartment in sensilla or elsewhere on the proboscis tip was found that labelled stronger with anti-ApolGOBP2 than sensillum lymph or the subcuticular space in sensilla styloconica.
Identification of proboscis soluble proteins
Proboscis homogenates of M. brassicae were electrophoretically compared with homogenates of male antennae and legs. The electrophoretic pattern of proboscis extracts after separation of proteins by native-PAGE was comparable with that of antennal extracts, while the more acidic bands were missing in legs (see arrows in Figure 4A). In western blots using anti-ApolGOBP2 serum, two bands were labelled in antennae and proboscis extracts and one band in the leg extract (Figure 4B). Only one band corresponding to the MbraPBPs in antennal extract (Bohbot et al., 1998
) was labelled by anti-ApolPBP serum (Figure 4C). The bands labelled with anti-ApolGOBP2 serum were submitted to N-terminal sequencing. In antennae, proboscis and legs, the upper band contains the major sequence EDKY mixed with minor sequences. In antennae, the lower band contains the TAEVM sequence of MbraGOBP2, as previously determined (Nagnan-Le Meillour et al., 1996
; Bohbot et al., 1998
). In the proboscis, the lower band contains a mixture of two sequences, DAPAASPLQDIEKHA (82%) and SEEDKAAFEEAAEPI (18%).
|
We tested the affinity between homogenates of proboscis and different tritium-labelled compounds in binding assays. The upper band detected with anti-ApolGOBP2 serum (EDKY sequence) was labelled by the four tritiated analogues of pheromones (Figure 4D). To better determine the binding specificity and assignment of the different bands we purified the proteins from the proboscis homogenates.
Purification of proboscis soluble proteins and their affinity for pheromone analogues
An homogenate of 1400 probosces was split into seven samples corresponding to 200 proboscis equivalents. The chromatograms obtained with the seven samples were identical with respect to peak retention times. The fractions corresponding to the same retention time were pooled for further analysis. Fractions between 0 and 35 min and 55 and 80 min were checked by native-PAGE and binding assay; they did not contain proteins of interest (data not shown). Figure 5 shows the chromatogram of fractions from 36 to 54 min, numbered 119, and the corresponding Coomassie stained native gel.
|
The proteins collected in the 19 fractions were tested in binding assays with the four pheromone analogues as above (Figure 6). Positive binding was observed not only in fractions 13 and 14, containing the EDKY sequence (band D), as already found in total extracts, but also in fractions 13, 6 and 7. In fraction 1, band A has strong affinity for 16:Ac (Figure 6B), Z1116:OH (Figure 6C) and Z1118:Ac (Figure 6D), but has no affinity for Z1116:Ac (Figure 6A). Band A in fraction 2 binds all four pheromone analogues. The same band A in fraction 3 has strong affinity for both 16:Ac (Figure 6B) and Z1118:Ac (Figure 6D). Band B in fraction 6 has affinity for 16:Ac, Z1116:OH and Z11 18:Ac, but no affinity for Z1116:Ac. Band B in fraction 7 binds 16:Ac and Z1118:Ac. Band C and an additional band (B') just above band B contained in the same fraction bind only Z1118:Ac.
|
Identification of proboscis soluble proteins by N-terminal sequencing
Bands B and C from fractions 6 and 7 contain the same N-terminal sequence, EEAHYTDRYDNVDLDEILGN. Band D collected in fractions 13 and 14 contains the pure N-terminal sequence EDKYTDKYDNINLDEILANK. The chromatogram (Figure 5) indicates that in each case (fractions 6, 7, 13 and 14) the two sequences could correspond either to isoforms sharing the same N-terminus or to the same protein eluted in two fractions. In addition, binding between fraction 7 and Z1118:AC resulted in one more labelled band (B') above band B, corresponding to the same N-terminus EEAHY (Figure 6D). In fraction 7, no differences in the three primary sequences of bands B, C and B' could be observed in the 20 first N-terminal residues (but see Discussion).
N-terminal sequencing of the band A in fractions 13 gave the pure sequence AKLTTEELQMLEAFD, which was not immunodetected by anti-ApolGOBP2 serum. The other proteins contained in HPLC fractions gave negative binding and were not further studied here.
Cloning and cDNA sequencing
3'-RACEPCR amplifications were performed using degenerate primers corresponding to the determined N-terminal sequences of the proteins together with the anchor oligo(dT). Products of 650 and 480 bp were obtained using the EDKY primer and the EEAH primer, respectively. After cloning and sequencing, we obtained seven different sequences, five of which encoded 112 amino acids with the N-terminal sequence EDKY, two of which encoded 108 amino acids with the N-terminal sequence EEAH. These proteins were named CSP-MbraA1CSP-MbraA5 (EDKY N-terminal sequence) and CSP-MbraB1 and CSP-MbraB2 (EEAH N-terminal sequence), for chemosensory proteins, according to Angeli et al. (Angeli et al., 1999
).
Nucleotide sequences have been deposited in the GenBank database with accession nos AF211177AF211183 for CSP-MbraA1CSP-MbraA5 and CSP-MbraB2 and CSP-MbraB2. Figure 7 shows the alignment of amino acid sequences deduced from the seven clones. Theoretical molecular masses and isoelectric points were calculated using MWCALC (Infobiogen). They range between 12 665 and 13 115 Da for molecular masses and between 5.34 and 6.66 for pI. The full-length sequences revealed four cysteines in conserved positions in the seven protein sequences. These could be involved in two disulphide bridges, as has been shown for the CSP of Schistocerca gregaria (Cys57Cys60 and Cys29Cys38) (Angeli et al., 1999
). The five deduced amino acid sequences CSP-MbraA matched the first 20 amino acids of these proteins as determined by Edman degradation. They differed from each other by only 13 residues (9997% identity). CSP-MbraB2 differed from the sequence obtained by Edman degradation by 1 residue, whereas CSP-MbraB1 matched totally with the N-terminal sequence. CSP-MbraB1 and CSP-MbraB2 differed from each other by 18 residues (83.3% identity). Identity percentages between the different CSP-MbraA and CSP-MbraB varied around 50%.
|
| Discussion |
|---|
|
|
|---|
Morphology of proboscis sensilla and localization of proboscis soluble proteins
The sensilla styloconica on the proboscis of M. brassicae in their fine structure closely resemble those on the proboscis of R. bubo (Arctiidae) (Altner and Altner, 1986
), Choristoneura fumiferana (Tortricidae) (Walters et al., 1998
) and Vanessa cardui (Nymphalidae) (Krenn, 1998
). Common features are the prominent stylus, the terminal pore at the tip of the cone, which is innervated by dendrites from three receptor cells, and the existence of a fourth mechanoreceptive neuron ending with a tubular body at the base of the cone. Thus, the general morphology of these proboscis sensilla in Lepidoptera apparently follows a common plan.
There are, however, a few striking differences in sensillar number and fine structure. While the counts of sensilla styloconica/galea were only 35 and 28 in Choristoneura and Vanessa, respectively, these were 102 in Rhodogastria and 121 in Mamestra. Moreover, a subset of sensilla styloconica in Rhodogastria was reported to display wall pores in addition to the terminal pore. Such wall pores were also shown in the present study but were not found in Choristoneura or Vanessa. In Mamestra, as in Rhodogastria, two subtypes of sensilla styloconica might occur (Figure 1D,E), however, our scanning electron micrographs indicate wall pores in both subtypes (Figure 1D,E). The presence of wall pores and the tendency of one of the outer dendritic segments to form branches were discussed by Altner and Altner (Altner and Altner, 1986
) as hinting at an olfactory function of these proboscis sensilla in addition to contact chemoreception. Unfortunately, to our knowledge this was never confirmed by electrophysiological experiments in this or any other lepidopteran species.
The weak labelling of proboscis sensilla of Mamestra with antisera against OBPs of A.polyphemus was expected from the western blots, which necessitated long exposure times and extremely sensitive detection methods. Anti-ApolPBP did not produce even weak labelling, while anti-ApolGOBP2 produced a signal in the sensillum lymph of sensilla styloconica of Mamestra that hardly exceeded the background. It should be mentioned that the antisera used were not previously affinity purified, as such purification often results in loss of the most strongly binding antibodies of the serum. Such crude sera are very specific, if used at high dilutions (1:>1000). At low dilutions, they may become rather non-specific and the distinction between specific signal and non-specific background is difficult. Pre-immune sera can give helpful information about non-specific binding only if applied at much higher concentrations than the antisera, in order to compensate for their lower titer. The possibility, that the antiserum contained in addition antibodies against OS-D-like proteins is rather improbable, since in native gels these proteins have highly different mobilities to GOBP2 (see Figure 4) and, therefore, should not have electroeluted together. The cross-reactivity is most probably due to common epitopes borne by proteins that could have a similar function (see below).
An immunolabelling signal as low as in the present case cannot provide convincing information about the localization of an antigen. Nevertheless, the weak cross-reactivity of proboscis chemosensory proteins with antisera against moth OBPs led to the characterization and sequencing of new chemosensory proteins, and binding studies with radioactive compounds indeed showed their odorant-binding capacity (see below). Furthermore, almost all insect OBPs and OBP-related proteins identified so far were localized in the sensillum lymph of various olfactory and gustatory sensilla, therefore, the labelling of the sensillum lymph of sensilla styloconica, which morphologically feature mixed traits of olfactory and gustatory function, is in line with the general localization of OBPs. Even the labelling of the subcuticular space is not an entirely new finding, but has been observed with anti-PBPRP2 in Drosophila (Park et al., 2000
). Thus, the sensilla styloconica are the most likely place where the observed proboscis chemosensory proteins are expressed.
Immunodetection
In western blot experiments, proteins from the proboscis are immunoreactive with antisera raised against ApolGOBP2 but not with antisera raised against ApolPBP (Figure 4B,C). A relatively long time of exposure (10 min) was necessary to obtain labelling, compared with the antennal proteins, that give a signal in <1 min (Figure 4B). This suggests that the proboscis proteins have poor homology with the PBP and GOBP classes previously defined by Vogt et al. (Vogt et al., 1991
). Indeed, MbraPBPs and MbraGOBP2 are absent from the proboscis, as antisense RNA probes deduced from these sequences gave no signal on probosces in in situ hybridization experiments (E. Jacquin-Joly, unpublished results).
Binding with tritiated pheromone analogues
The four tritiated pheromone analogues were chosen because they are either produced in the female gland (Z1116:Ac, 92% of the pheromonal blend; 16:Ac, 7%) (Descoins et al., 1978
) or are specifically detected by conspecific males as a behavioural inhibitor (Z1116:OH) (Farine et al., 1981
). Z1118:Ac (vaccenyl acetate) was recently identified as a minor component of the M. brassicae female pheromonal secretion (P. Nagnan-Le Meillour and E. Jacquin-Joly, unpublished results). In addition, they are the only specific tritiated ligands available for such a study.
In total extracts, the four tritiated pheromones are only bound in band D, containing the sequence EDKY. After purification, binding with pheromone analogues revealed additional labelling, at the level of bands AC. The different results obtained with total extracts and purified fractions could be explained either by protein enrichment in a given fraction or by the fact that in total extracts proteins are in competition to bind pheromones. In this latter case, one can assume that the EDKY protein in band D has the highest affinity for the four ligands. In the purified fractions, there is no competition and other proteins (EEAH and AKLT) with less affinity for the ligands can bind them. It is worth noting that the four coumpounds used in this study are structurally close and could be in competition for the binding site of Mamestra OBPs. In addition, we have previously shown that components of the M. brassicae pheromone, not detected by species such as Bombyx mori or Antheraea pernyi, gave negative binding with antennal extracts of these species (Bohbot et al., 1998
). Moreover, in antennal extracts, vaccenyl acetate is only bound by proteins of the EDKY sequence and not by the antennal-specific MbraPBPs and MbraGOBP2 (Bohbot et al., 1998
), which were not detected in proboscis extracts. Thus, the proboscis proteins have a strong affinity for pheromonal compounds, but they show remarkably little selectivity for the different odorants tested, which was expected from the binding results obtained with antennal extracts, where similar proteins bind the four pheromone analogues (Bohbot et al., 1998
).
Characterization of proboscis soluble proteins
Proteins corresponding to three different N-terminal sequences were able to bind pheromones in vitro. For each of the N-terminal sequences, EDKY and EEAH, several isoforms were identified, migrating at distinct positions in native-PAGE, reflecting different isoelectric points. To confirm the presence of several isoforms, several clones were sequenced after the amplification of cDNAs from probosces. Different protein sequences were obtained, sharing high identities, with isoelectric points ranging from 5.34 to 6.66, which explains the different positions in native-PAGE. Molecular cloning demonstrated the presence of isoforms in two protein classes, CSP-MbraA and CSP-MbraB, confirming the observation of several bands sharing the same N-terminal sequence on the gels. As the PCR amplifications and biochemical studies were carried out on a pool of probosces, this could reflect either expression of several alleles in each individual or expression of alleles in the population. However, many CSP isoforms have been found in individual S. gregaria legs (Angeli et al., 1999
), reflecting a real microdiversity in the same animal, although we do not know if this is the case in M. brassicae.
A search for sequence similarity in databases showed remarkable homologies between M. brassicae proboscis proteins and other proteins previously characterized in several orders of insects (Figure 8). These proteins are called OS-D like (Vogt et al., 1999
), because the first member of this family was the OS-D gene product, discovered in D. melanogaster (McKenna et al., 1994
; Pikielny et al., 1994
). The proboscis proteins CSP-MbraA (EDKY N-terminus) show 99% similarity in the N-terminus with the antennal isoform MbraAOBP2 (Bohbot et al., 1998
) (E. Jacquin-Joly, unpublished results). The amino acid sequence similarity in the OS-D-like family of proteins has a constant value around 50%, irrespective of phylogenetic relationship. In addition, the N-terminal deduced amino acid sequences of the proboscis proteins also share a high percentage identity with partial amino acid sequences of a purified protein from the bee (ASP3) (Danty et al., 1998
) as well as proteins from the Phasmatodea (Mameli et al., 1996
; Tuccini et al., 1996
).
|
The last sequence corresponding to positive binding in the proboscis is AKLT. Searches in databases using BLASTp (National Center for Biotechnology Information, NCBI) revealed no homologies with known proteins. This protein does not belong to the class mentioned above.
The OS-D-like class differs from the PBPs and GOBPs, the two OBP classes primarily defined by Vogt et al. (Vogt et al., 1991
) based on homology criteria, in several aspects. (i) There is no sequence motif conserved between OBPs and OS-D-like proteins, suggesting that there is no recent ancestral gene from which these two groups emerged through a gene duplication event, as was shown for the PBP class (Merrit et al., 1998
; Vogt et al., 1999
). (ii) OBPs are highly divergent within and between species (Vogt et al., 1999
) while the OS-D-like proteins are highly conserved within species but homogeneously divergent between species (
50%). (iii) While OBPs are antenna-specific (Vogt and Riddiford, 1981
), the OS-D-like proteins are commonly observed to be expressed in diverse organs [proboscis, antennae and legs in M. brassicae (this study); legs and antennae in S. gregaria (Angeli et al., 1999
), Periplaneta americana (Kitabayashi et al., 1998
); maxillary palps in Cactoblastis cactorum (Maleszka and Stange, 1997
); the ejaculatory bulb (Dyanov and Dzitoeva, 1995
); the third antennal segment in Drosophila (McKenna et al., 1994
; Pikielny et al., 1994
)]. (iv) OBPs have consistently been shown to discriminate between odorants (Vogt et al., 1989
; Du and Prestwich, 1995
; Maïbèche-Coisné et al., 1997
; Wojtasek et al., 1999
) while we demonstrate in this report that proboscis proteins have little selectivity for the odorants tested.
Function of the proboscis chemosensory proteins
The characterization of OBP-related proteins in organs typically devoted to taste functions has already been reported in D. melanogaster for PBPRP-2 (Pikielny et al., 1994
; Ozaki et al., 1995
) and in Phormia regina for CRLBP (Ozaki et al., 1995
). In P. regina, electrophysiological studies have shown that the responses of the fifth cell to fragrant components of apple juice are depressed in the presence of antibodies raised against CRLBP. The authors suggested that these proteins could be involved in the recognition of volatile, more generally lipophilic signals from plants, either in the antennae or in the taste organs.
Furthermore, a general body sensitivity to vapours, after removal of all known olfactory receptors, was early reported by McIndoo (McIndoo, 1934
). The eventuality that insects could possess a common chemical sensitivity to vapours has been the subject of discussion (Dethier, 1972
). The characterization of proteins able to bind pheromones in the proboscis reactualizes such a possibility. Several roles were proposed for this class of proteins, without supporting functional data. In C. cactorum, the protein is expressed in maxillary palps, involved in CO2 detection (Maleszka and Stange, 1997
) but binding experiments between S. gregaria CSPs and CO2 was negative (Angeli et al., 1999
). The p10 protein is expressed in regenerating legs of Periplaneta americana and was proposed to be involved in the regeneration process (Kitabayashi et al., 1998
). In D. melanogaster, EBSPIII protein could be involved in the transmission of vaccenyl acetate from the male to the female during copulation (Dyanov and Dzitoeva, 1995
). Our data support a role in binding of lipophilic molecules, such as odorants. Considering the available data, we propose distinguishing between the PBP and GOBP families (OBP-Type 1) and chemosensory proteins related to the OS-D gene family (OBP-Type 2), as recently suggested by Vogt et al. (Vogt et al., 1999
).
These findings lead to the hypothesis that the same proteins could be involved in different physiological process according to their localization. Their ability to bind pheromones could be a biochemical property leading to different physiological functions depending on their localization and, thus, the cellular environment. Proteins of the CSP-Mbra subclass could be involved in either olfactory transduction when expressed in antennae or in other mechanisms (transport, deactivation) when expresssed in other organs.
The question of whether the binding with pheromonal compounds is specific or not remains and can only be solved by electrophysiological studies, which are strongly needed.
| Acknowledgments |
|---|
The authors are grateful to D. Tauban (Versailles) for scanning electron microscopy and C. Bock (Seewiesen) for the high resolution scanning micrographs.
| References |
|---|
|
|
|---|
Altner, H. and Altner, I. (1986) Sensilla with both terminal pore and wall pores on the proboscis of the moth, Rhodogastria bubo Walker (Lepidoptera: Arctiidae). Zool. Anz., 216, 129150.
Angeli, S., Ceron, F., Scaloni, A., Monti, M., Monteforti, G., Minocci, A., Petacchi, R. and Pelosi, P. (1999) Purification, structural characterization, cloning and immunocytochemical localization of chemoreception proteins from Schistocerca gragaria. Eur. J. Biochem., 262, 745754.[Web of Science][Medline]
Bock, C. (1987) A quick and simple method for preparing soft insect tissues for scanning electron microscopy using Carnoy and hexamethyldisilazane. Beitr. Zurelek. Direktabb. Oberflächen, 20, 209214.
Bohbot, J., Sobrio, F., Lucas, P. and Nagnan-Le Meillour, P. (1998) Functional characterisation of a new class of odorant-binding proteins in the moth Mamestra brassicae. Biochem. Biophys. Res. Commun., 253, 489494.[Web of Science][Medline]
Büttiker, W., Krenn, H.W. and Putterill, J.F. (1996) The proboscis of eye-frequenting and piercing Lepidoptera (Insecta). Zoomorphology, 116, 7783.[Web of Science]
Danscher, G. (1981) Localization of gold in biological tissuea photochemical method for light and electron microscopy. Histochemistry, 71, 8188.[Web of Science][Medline]
Danty, E., Arnold, G., Huet, J.C., Huet, D., Masson, C. and Pernollet, J.C. (1998) Separation, characterization and sexual heterogeneity of multiple putative odorant-binding proteins in the honeybee Apis mellifera L. (Hymenoptera: Apidea). Chem. Senses, 23, 8391.[Abstract]
Descoins, C., Priesner, E., Gallois, M., Arn, H. and Martin, G. (1978) Sur la sécrétion phéromonale des femelles de Mamestra brassicae L. et de Mamestra oleracea L. (Lepidoptera: Noctuidae, Hadeninae). C. R. Acad. Sci., 286, 7780.
Dethier, V.G. (1972) Sensitivity of the contact chemoreceptors of the blowfly to vapors. Proc. Natl Acad. Sci. USA, 69, 21892192.
Dyanov, H.M. and Dzitoeva, S.G. (1995) Method for attachment of microscopic preparartions on glass for in situ hybridization, PRINS and in situ PCR studies. Biotechniques, 18, 822824.[Web of Science][Medline]
Du, G. and Prestwich, G.D. (1995) Protein structure encodes the ligand binding specificity in pheromone binding proteins. Biochemistry, 34, 87268732.[Medline]
Eastham, L.E.S. and Eassa Y.E.E. (1955) The feeding mechanism of the butterfly Pieris brassicae L. Phil. Trans. R. Soc. Lond. Ser. B, 239, 143.
Farine, J.P., Frérot, B. and Isart, J. (1981) Facteurs disolement chimique dans la sécrétion phéromonale de deux noctuelles Hadeninae: Mamestra brassicae (L.) and Pseudaletia unipuncta (Haw.). C.R. Acad. Sci. Paris III, 292, 101104.
Faucheux, M.J. (1991) Morphology and distribution of sensilla on the cephalic appendages, tarsi and ovipositor of the European sunflower moth, Homoeosoma nebulella Den. and Schiff. (Lepidoptera: Pyralidae). Int. J. Morphol. Embryol., 20, 291307.
Kitabayashi, A.N., Arai, T., Kubo, T. and Natori, S. (1998) Molecular cloning of cDNA for p10, a novel protein that increases in the regenerating legs of Periplaneta americana (American cockroach). Insect Biochem. Mol. Biol., 28, 785790.[Web of Science][Medline]
Krenn, H.W. (1998) Proboscis sensilla in Vanessa cardui (Nymphalidae, Lepidoptera): functional morphology and significance in flower-probing. Zoomorphology, 118, 2330.[Web of Science]
Kyhse-Andersen, J. (1984) Electroblotting of multiple gels: a simple apparatus without tank buffer for rapid transfer of proteins from polyacrylamide to nitrocellulose. J. Biochem. Biophys. Methods, 10, 203209.[Web of Science][Medline]
Laue, M., Steinbrecht, R.A. and Ziegelberger, G. (1994) Immunocytochemical localization of general odorant-binding protein in olfactory sensilla of the silkmoth Antheraea polyphemus. Natürwissenschaften, 81, 178180.
Maïbèche-Coisné, M., Sobrio, F., Delaunay, T., Lettéré, M., Dubroca, J., Jacquin-Joly, E. and Nagnan-Le Meillour, P. (1997) Pheromone-binding proteins of the moth Mamestra brassicae: specificity of ligand binding. Insect Biochem. Mol. Biol., 27, 213221.
Maïbèche-Coisné, M., Longhi, S., Tegoni, M., Jacquin-Joly, E., Gastinel, L., Cambillau, C. and Nagnan-Le Meillour, P. (1998a) Molecular cloning and bacterial expression of a General Odorant Binding Protein in the cabbage armyworm Mamestra brassicae. Eur. J. Biochem., 258, 768774.[Web of Science][Medline]
Maïbèche-Coisné, M., Jacquin-Joly, E., François, M.C. and Nagnan-Le Meillour, P. (1998b) Molecular cloning of two pheromone-binding proteins in the cabbage armyworm Mamestra brassicae. Insect Biochem. Mol. Biol., 28, 815818.[Web of Science][Medline]
Malezska, R. and Stange, G. (1997) Molecular cloning, by a novel approach, of a cDNA encoding a putative olfactory protein in the labial palps of the moth Cactoblastis cactorum. Gene, 202, 3943.[Web of Science][Medline]
Mameli, M., Tuccini, A., Mazza, M., Petacchi, R. and Pelosi, P. (1996) Soluble proteins in chemosensory organs of phasmids. Insect Biochem. Mol. Biol., 26, 875882.[Web of Science][Medline]
Marshall, A.T. and Kent, M. (1991) A device for freeze-substituting a large number of samples under controlled conditions. J. Microsc., 162, 335340.[Web of Science][Medline]
McIndoo, N.E. (1934) J. Morphol., 56, 445475.
McKenna, M.P., Hekmat-Scafe, D., Gaines, P. and Carlson, J.R. (1994) Putative Drosophila pheromone-binding proteins expressed in a subregion of the olfactory system. J. Biol. Chem., 10, 1634016347.
Merrit, T. J. S., LaForest, S., Prestwich, G. D., Quattro, J. M. and Vogt, R.G. (1998) Patterns of gene duplication in lepidopteran pheromone binding proteins. J. Mol. Evol., 46, 272276.[Web of Science][Medline]
Nagnan-Le Meillour, P., Huet, J.C., Maïbèche, M., Pernollet, J.C. and Descoins, C. (1996) Purification and characterization of multiple forms of odorant/pheromone binding proteins in the antennae of Mamestra brassicae (Noctuidae). Insect Biochem. Mol. Biol., 26, 5967.[Web of Science][Medline]
Ozaki, M., Morisaki, K., Idei, W., Ozaki, K. and Tokunaga, F. (1995) A putative lipophilic stimulant carrier protein commonly found in the taste and olfactory systems. A unique member of the pheromone-binding protein superfamily. Eur. J. Biochem., 230, 298308.[Web of Science][Medline]
Park, S.-K., Shanbhag, S.R., Wang, Q., Hasan, G., Steinbrecht, R.A. and Pikielny, C.W. (2000) Different expression patterns of two putative odorant-binding proteins in the olfactory organs of Drosophila have different implications for their functions. Cell Tissue Res., 300, 181192.[Web of Science][Medline]
Paulus, H.F. and Krenn, H.W. (1996) Vergleichende Morphologie des Schmetterlingsrüssels und seiner SensillenEin Beitrag zur phylogenetischen Systematik der Papilionoidea (Insecta, Lepidoptera). J. Zool. Syst. Evol. Res., 34, 203216.
Pikielny, C., Hasan, G., Rouyer, F. and Rosbach, M. (1994) Members of a family of Drosophila putative odorant binding proteins are expressed in different subsets of olfactory hairs. Neuron, 12, 3549.[Web of Science][Medline]
Poitout, S. and Bues, R. (1974) Elevage de 28 espèces de lépidoptères Noctuidae et de deux espèces dArctiidae sur milieu artificiel simplifié. Particularités selon les espèces. Ann. Zool. Ecol. Anim., 6, 431441.
Sellier, R. (1975) Etude ultrastructurale en microscopie électronique par balayage des organes sensoriels de la trompe des Lépidoptères Rhopalocères. Alexanor Rev. Lepidop. Fr., 9, 915.
Städler, E. and Hanson, F.E. (1975) Olfactory capabilities of the gustatory chemoreceptors of the tobacco hornworm larvae. J. Comp. Physiol., 104, 97102.
Städler, E. and Seabrook, W.D. (1975) Chemoreceptors on the proboscis of the female eastern spruce budworm: electrophysiological study. Entomol. Exp. Appl., 18, 153160.
Städler, E., Städler-Steinbrüchel, M. and Seabrook, W.D. (1974) Chemoreceptors on the proboscis of the female eastern spruce budworm. Mitt. Schweiz. Entomol. Ges., 47, 6368.
Steinbrecht, R.A. (1993) Freeze-substitution for morphological and immunocytochemical studies in insects. Microsc. Res. Tech., 24, 488504.[Web of Science][Medline]
Steinbrecht, R.A., Ozaki, M. and Ziegelberger, G. (1992) Immunocytochemical localization of pheromone-binding protein in moth antennae. Cell Tissue Res., 270, 287302.[Web of Science]
Steinbrecht, R.A., Laue, M. and Ziegelberger, G. (1995) Immunolocalization of pheromone-binding protein and general odorant-binding protein in olfactory sensilla of the silk moths Antheraea and Bombyx. Cell Tissue Res., 282, 203217.[Web of Science]
Tuccini, A., Maida, R., Rovero, P., Mazza, M. and Pelosi, P. (1996) Putative odorant-binding protein in antennae and legs of Carausius morosus Insecta, Phasmatodea. Insect Biochem. Mol. Biol., 26, 1924.[Web of Science][Medline]
Vogt, R.G. and Riddiford, L.M. (1981) Pheromone-binding and inactivation in moth antennae. Nature, 293, 161163.[Medline]
Vogt, R.G., Köhne, A.C., Dubnau, J.T. and Prestwich, G.D. (1989) Expression of pheromone-binding proteins during antennal development in the gypsy moth Lymantria dispar. J. Neurosci., 9, 33323346.[Abstract]
Vogt, R.G., Prestwich, G.D. and Lerner, M.R. (1991) Odorant-binding protein subfamilies associate with distinct classes of olfactory receptor neurons in insects. J. Neurobiol., 22, 7484.[Web of Science][Medline]
Vogt, R.G., Callahan, F.E., Rogers, M.E. and Dickens, J.C. (1999) Odorant Binding Protein diversity and distribution among the insect orders, as indicated by LAP, an OBP-related protein of the true bug Lygus lineolaris (Hemiptera, Heteroptera). Chem. Senses, 24, 481495.
Walters, B.D., Albert, P.J. and Zacharuk, R.Y. (1998) Morphology and ultrastrucuture of sensilla on the proboscis of the adult spruce budworm, Choristoneura fumiferana (Clem.) (Lepidoptera: Tortricidae). Can. J. Zool., 76, 466479.
Wojtasek, H., Picimbon, J.-F. and Leal, W.S. (1999) Identification and cloning of Odorant Binding Proteins from the scarab beetle Phyllopertha diversa. Biochem. Biophys. Res. Commun., 263, 832837.[Web of Science][Medline]
Accepted March 17, 2000
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J.-J. Zhou, Y. Kan, J. Antoniw, J. A. Pickett, and L. M. Field Genome and EST Analyses and Expression of a Gene Family with Putative Functions in Insect Chemoreception Chem Senses, June 1, 2006; 31(5): 453 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maibeche-Coisne, C. Merlin, M.-C. Francois, I. Queguiner, P. Porcheron, and E. Jacquin-Joly Putative Odorant-degrading Esterase cDNA from the Moth Mamestra brassicae: Cloning and Expression Patterns in Male and Female Antennae Chem Senses, June 1, 2004; 29(5): 381 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Campanacci, A. Lartigue, B. M. Hallberg, T. A. Jones, M.-T. Giudici-Orticoni, M. Tegoni, and C. Cambillau Moth chemosensory protein exhibits drastic conformational changes and cooperativity on ligand binding PNAS, April 29, 2003; 100(9): 5069 - 5074. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lartigue, V. Campanacci, A. Roussel, A. M. Larsson, T. A. Jones, M. Tegoni, and C. Cambillau X-ray Structure and Ligand Binding Study of a Moth Chemosensory Protein J. Biol. Chem., August 23, 2002; 277(35): 32094 - 32098. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Jacquin-Joly, R. G. Vogt, M.-C. Francois, and P. Nagnan-Le Meillour Functional and Expression Pattern Analysis of Chemosensory Proteins Expressed in Antennae and Pheromonal Gland of Mamestra brassicae Chem Senses, September 1, 2001; 26(7): 833 - 844. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||










