Chem. Senses 27: 319-332,
2002
© Oxford University Press 2002
Novel Odorant-binding Proteins Expressed in the Taste Tissue of the Fly
Biological Institute, Graduate School of Science, Tohoku University, Aoba-ku, Sendai 980-8578, Japan
Correspondence to be sent to: Masayuki Koganezawa, Biological Institute, Graduate School of Science, Tohoku University, Aoba-ku, Sendai 980-8578, Japan. e-mail: kogane{at}mail.cc.tohoku.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and methodsResultsDiscussionReferences |
|---|
A taste tissue cDNA library of the fleshfly Boettcherisca peregrina was screened with a subtracted cDNA probe enriched with taste-receptor-tissue-specific cDNA. Seven genes were identified with sequence similarity to insect odorant-binding protein (OBP) genes. The predicted amino acid sequences of the genes contain the putative signal peptide sequence at the N-terminal and most of them conserve the six cysteines common to known insect OBPs. These genes show a high degree of sequence divergence with
20% amino acid identity. The most striking feature was that all seven of
these genes are expressed mainly in the taste tissues, such as the labellum
and tarsus, unlike the known insect OBP genes expressed in olfactory tissue.
The predicted amino acid sequences had the highest degree of sequence
similarity to the Drosophila melanogaster OBPs named pheromone
binding protein-related proteins (PBPRPs). These gene products are here
referred to as gustatory PBP-related proteins (GPBPRPs) 1-7. Homologous GPBPRP
genes were found also in D. melanogaster by database search and are
shown to be expressed in Drosophila taste tissues. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Odorant-binding proteins (OBPs) and pheromone binding proteins (PBPs) are small, water-soluble proteins identified from the chemosensory organs of vertebrates and insects (Pelosi and Maida, 1990
; Pelosi,
1996). The name `binding protein' originates from the facts that
PBP of moth binds with sex pheromones
(Vogt and Riddiford, 1981) and
that some mammalian OBPs bind with volatile odorants
(Pelosi et al.,
1982). There is no significant sequence similarity between insect
OBPs and vertebrate OBPs, but they are presumed to play a similar role
(Pelosi and Maida, 1990). The
electrical response of the chemosensory receptor cell is initiated by the
binding of stimulants with the receptor molecule on the cell membrane. Because
the receptor cells are surrounded by a hydrophilic environment, it is
considered that hydrophobic molecules such as volatile odorants or pheromones
have difficulty reaching the receptor cell membrane. OBPs are thought to
transport these hydrophobic molecules into the hydrophilic environment and
regulate the chemosensory response. The mutation of one OBP gene of
Drosophila, lush, results in abnormal chemoattractive behavior to
alcohol (Kim et al.,
1998). The antibody to one OBP-related protein of the blowfly
Phormia regina (chemical-sense-related lipophilic ligand-binding
protein, CRLBP) blocks the response of the taste receptor cell to a stimulant
containing hydrophobic molecules (Ozaki
et al., 1995). These functional studies support the idea
that OBPs can transport hydrophobic molecules.
The taste receptor organ of the fly is the chemosensory hair, many of which
are found on the labellum and tarsi. It has been one of the most intensively
used preparations at the single receptor cell level for electrophysiological
and pharmacological experiments because of its simple structure compared with
that of vertebrates. One chemosensory hair has only four receptor cells, named
the `sugar', `salt', `water' and `fourth' receptor cells, which respond
specifically to sugars and amino acids, salt, water and fatty acid salts,
respectively (Dethier, 1976;
Hansen, 1978;
Morita and Shiraishi, 1985;
Morita, 1992). Despite the
complexity of the vertebrate taste receptor organ, many kinds of molecular
components of vertebrate taste reception have been identified, including the
taste receptor molecules and the signal transduction molecules
(McLaughlin et al.,
1992; Ugawa et al.,
1998; Hoon et al.,
1999; Adler et al.,
2000; Chaudhari et
al., 2000; Matsunami
et al., 2000). In contrast, the nature of taste reception
at the molecular level in the fly is still unclear.
The differential screening method is often used to identify a gene
specifically expressed in a certain tissue. Applying this method to the study
of chemoreception, several kinds of genes have been cloned successfully, such
as the olfactory receptor genes of the mammalian vomeronasal organ
(Dulac and Axel, 1995), the
candidate mammalian taste receptor genes
(Hoon et al., 1999)
and the OBP genes of Drosophila
(McKenna et al.,
1994; Pikielny et
al., 1994). To identify genes related to taste reception in
the fleshfly Boettcherisca peregrina, we performed differential
screening of a taste tissue cDNA library. This cDNA library was screened with
a subtracted cDNA probe enriched with taste-receptor-tissue-specific cDNA to
ensure effective screening. In this procedure, 418 cDNA clones predominantly
expressed in the taste tissue were obtained, of which seven genes with
sequence similarity to insect OBP genes were identified and are here referred
to as gustatory pheromone binding protein-related proteins (GPBPRPs). The
expression of these genes was specific to taste tissue: strikingly different
from other insect OBPs, which are expressed predominantly in the antenna.
|
Materials and methods |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Animals
Two fly species were reared in our laboratory at 25°C and used for the experiments: the fleshfly, B. peregrina, and the fruitfly, D. melanogaster. For the latter, Canton-Special (CS) was used as the wild type.
Construction of the taste tissue cDNA library
The labella of adult fleshflies were dissected out under a microscope and
collected in a microcentrifuge tube cooled by dry ice—ethanol solution.
The samples were stored at -80°C until use. Poly(A)+ RNA was
extracted using a QuickPrep mRNA purification kit (Amersham Pharmacia
Biotech). The labellar cDNA library was constructed with a SuperScript Lambda
System for cDNA Synthesis and 
cloning (GIBCO BRL), following the
protocol provided.
To prepare taste-receptor-rich tissue (TRRT), adult fleshfly labella from which the pseudotracheal organ had been removed were collected in cold fly Ringer solution (111.2 mM NaCl, 55 mM KCl, 0.8 mM CaCl2, 1.2 mM NaHCO3, 0.08 mM NaH2PO4, 1.8 mM MgCl2, 5 mM HEPES, pH 7.1). Figure 1a shows a photograph of the dissected labellum and the pseudotracheal organ. Then the dissected labella were treated with 1 mg/ml collagenase (Sigma) in Ca2+-free Ringer solution (111.2 mM NaCl, 55 mM KCl, 1.2 mM NaHCO3, 0.08 mM NaH2PO4, 2.6 mM MgCl2, 5 mM HEPES, pH 7.1) for 40 min at 37°C. After the treatment, epidermal tissues were easily removed from the outer shell with microforceps. Figure 1b and c show the photograph of TRRT stained with methylene blue. TRRT have globular groups of cells connected with the outer shell (Figure 1c, arrow heads) which are presumed to contain only taste receptor cells, mechanosensory receptor cells and supporting cells (trichogen, tormogen and thecogen cells). Total RNA was extracted from TRRT using an RNeasy Mini kit (QIAGEN), then the first strand cDNA was synthesized using SuperScript II RNase H- Reverse Transcriptase (Gibco BRL). As the amount of RNA extracted from TRRT was very small, TRRT cDNA was amplified using a SMART PCR cDNA synthesis kit (Clontech), following the protocol provided.
|
Adaptor-ligated double-strand cDNAs of labella or TRRT were ligated into
ZIPLox (GIBCO BRL), and then in vitro packaging was
performed using a Gigapack III Gold packaging extract (Stratagene). Y1090(ZL)
(Gibco BRL) was used as the host cell.
Generation of subtracted cDNA probe
The subtraction of non-taste tissue cDNA from the taste tissue cDNA was performed using a Clontech PCR-Select cDNA subtraction kit (Clontech). TRRT and tarsus were used as the taste-receptor-cell-containing tissues. Eye, antenna and femur were used as the tissues without taste receptor cells. We generated two kinds of subtracted cDNA probe: tarsus cDNA from which femur and antenna cDNA were subtracted [T—(F+A) probe] and TRRT cDNA from which eye cDNA was subtracted (TRRT—Eye probe). The starting materials for subtraction were total RNA for the T—(F+A) probe and SMART PCR-amplified cDNA for the TRRT—Eye probe. Southern blot analysis was performed to confirm the subtraction efficiency.
Differential screening to identify genes expressed in the taste tissue
The taste-tissue cDNA libraries were screened under high stringency with
the subtracted cDNA probe as the positive probe and the unsubtracted
non-taste-tissue cDNA as the negative probe. Each cDNA probe was labeled with
[
-32P]dCTP using an RTS RadPrime DNA labeling system (Gibco
BRL). The cDNA library was plated at low density to enable identification and
isolation of single plaques at the first screening (2000-5000 pfu in 9 cm
dish). Plaques hybridized with the positive probe, but not with the negative
probe, were selected. The cDNA inserted in a ZIPLox vector was
amplified by PCR using the vector-specific primers and Southern blot analysis
was performed as the second screening. Usually, PCR was performed using
AmpliTaq Gold DNA polymerase (Perkin-Elmer) and a TaKaRa PCR Thermal Cycler
MP. Each PCR product was electrophoresed, transferred to a membrane
(Hybond-N+; Amersham Pharmacia Biotech) and hybridized with the
positive probe or the negative probe under the high-stringency conditions.
Again, the clone selected was that hybridized with the positive probe but not
with the negative probe. The selected samples were recovered in the
autonomously replicating plasmid pZL1 using an in vivo excision
protocol provided by Gibco BRL. The cDNA inserts were sequenced using a
Labstation Thermo Sequenase labeled primer cycle sequencing kit with
7-deaza-dGTP (Vistra) and a Hitachi DNA sequencer 5500, or a ThermoSequenase
II cycle sequencing kit (Amersham Pharmacia Biotech) with an ABI 373A DNA
sequencing system.
Analysis of cDNA sequences
After the sequences of cDNA were determined, a homology search was performed using NCBI BLAST (http://www.ncbi.nlm.nih.gov ) and genes of interest were selected. After the full DNA sequence of the longest clone of each gene of interest was determined, the predicted amino acid sequence was determined. The signal peptide sequence cleavage site was predicted using the SignalP program (http://www.cbs.dtu.dk/services/SignalP ). The amino acid identity was calculated from the sequence after removal of the signal peptide sequence. The Clustal X program was used for multiple sequence alignment and the PHYLIP program package (Version 3.6a for Macintosh) was used for the phylogenetic analysis.
Virtual Northern blot analysis
The term `Virtual Northern blot' appears in the protocol of the SMART PCR
cDNA synthesis kit (Clontech) and refers to the method of blotting total cDNA
instead of RNA. Virtual Northern blot analysis can provide information similar
to that obtained by standard Northern blot analysis. The labella, tarsi,
antennae, eyes and guts of the fleshflies were collected and total RNA was
extracted using an RNeasy Mini kit (QIAGEN). The total RNA sample was treated
with RNase-free DNase I (Promega) to eliminate contamination with genomic DNA.
The first strand cDNA was synthesized by SuperScript II RNase H-
Reverse Transcriptase (Gibco BRL). Each cDNA was amplified using a SMART PCR
cDNA synthesis kit (Clontech). Amplified cDNAs (1500 ng) were electrophoresed,
transferred to nylon filter and hybridized with [-32P]dCTP
labeled probe under high-stringency conditions. The probes were prepared from
plasmid containing GPBPRP cDNA by PCR with the specific primers. The primer
sequences of each GPBPRP were as follows:
- GPBPRP1 forward primer,
- GTTTCGAATATTCGGGCGGA;
- GPBPRP1 reverse primer,
- TGCCAATTCTATGGCCGCAT;
- GPBPRP2 forward primer,
- GCTTCGATAAAAAACAAGCCCTCG;
- GPBPRP2 reverse primer,
- CTTTGCAACTGCCATGCGG;
- GPBPRP3 forward primer,
- GCTTTAATGTCGTTTGGTGAGGAC;
- GPBPRP3 reverse primer,
- TCAGAGAACATGGAACCCATTAGG;
- GPBPRP4 forward primer,
- CATCGCTGCTGTCAGTGCC;
- GPBPRP4 reverse primer,
- CAATTCCTTCCATTCCTCGGGT;
- GPBPRP5 forward primer,
- GAGGTTGCCAAAATACGCAGC;
- GPBPRP5 reverse primer,
- ATCACAGCGATCAGCACCCT;
- GPBPRP6 forward primer,
- ATACGTAGCACTTGTCAAGCGG;
- GPBPRP6 reverse primer,
- CCCTATTTAAACCATTTACGCACA;
- GPBPRP7 forward primer,
- TTTGCTTTATTGCTGGCGCTT;
- GPBPRP7 reverse primer,
- CATCATCTTGTACTTGGCCGTCC.
Each primer has a similar Tm value and the annealing temperature of PCR was set at 60°C for all reactions. The sizes of PCR products are 222 bp (GPBPRP1), 260 bp (GPBPRP2), 203 bp (GPBPRP3), 271 bp (GPBPRP4), 213 bp (GPBPRP5), 305 bp (GPBPRP6) and 231 bp (GPBPRP7).
RT-PCR analysis
Labella, tarsi, antennae, heads devoid of antennae and proboscis, and guts of adult fleshflies were collected. For other experiments, the heads (including the first and second segments) of third larval stage and the labella of adult males and females were also collected. Poly(A)+ RNA was extracted using a QuickPrep mRNA purification kit (Amersham Pharmacia Biotech). An RNase-free DNase I treated poly(A)+ RNA sample of each tissue was used for the first strand cDNA synthesis. The amount of RNA in this first strand cDNA synthesis was standardized for each tissue. The specific primers for each GPBPRP are shown above. The number of cycles of RT-PCR was 24. The ribosomal protein 49 (RP49) gene was used as the internal control for each cDNA sample. To amplify the RP49 gene of Boettcherisca, we used the primers for the RP49 gene of D. melanogaster and performed RT—PCR at a low annealing temperature. The annealing temperature for RT—PCR of RP49 for Drosophila was 65°C, but that in Boettcherisca was 55°C. The amplified product was confirmed to have a high degree of sequence similarity with the RP49 gene of Drosophila (data not shown). The sequence of the primers for the RP49 gene of Drosophila are as follows:
- RP49 forward primer,
- AGATCGTGAAGAAGCGCACCAAG;
- RP49 reverse primer,
- CACCAGGAACTTCTTGAATCCGG.
The number of cycles of RT—PCR was determined so as not to reach the plateau of the reaction.
In the RT—PCR analysis of Drosophila GPBPRP gene homologs,
labella, tarsi, antennae and heads devoid of proboscis and antennae were
collected. One mutant, pox-neuro70
(poxn70), was used to investigate the expression pattern
of Drosophila GPBPRP gene homologs. The gene poxn encodes a
possible transcriptional regulator and controls the differentiation of
mechanosensory and chemosensory cells
(Dambly-Chaudiere et al.,
1992; Nottebohm et
al., 1994; Awasaki and
Kimura, 1997). In homozygous
poxn70/poxn70 flies, the chemosensory hairs
(polyinnervated bristles) in the labellum and tarsus are transformed into
mechanosensory bristles—monoinnervated bristles
(Awasaki and Kimura, 1997).
There are no taste receptor cells in the transformed bristle. Heterozygous
poxn70/+ flies show the normal phenotype of chemosensory
hair and were used as control animals in RT—PCR analysis. Total RNA was
extracted using an RNeasy Mini kit (QIAGEN). Other protocols were the same as
those described above for Boettcherisca. The primer sequences were as
follows:
- CG1670 forward primer,
- AATGTCATGGCTATCGCCGGTT;
- CG1670 reverse primer,
- TTATACTGCAACTGATCCTCGGGC;
- CG11218 forward primer,
- ATGAAGTTCCTGATTGTCCTCTCCG;
- CG11218 reverse primer,
- GGCGCGATTCTTGTAGTAGCACTC;
- CG11797 forward primer,
- TGAGTGCTCTTTTTGTGACTCTGGC;
- CG11797 reverse primer,
- GGTATCACACTTGTTCTCGCCCTTG;
- CG13421 forward primer,
- TCTTGACTGTCAGCGTGGTCTCC;
- CG13421 reverse primer,
- CTTCGGTGACCTCATCGCTCTG.
Each primer has a similar Tm value and the annealing temperature for PCR was set at 65°C for all reactions. The numbers of cycles of RT—PCR were 28 (CG11218, CG11797, CG13421 and RP49) and 42 (CG1670). The sizes of PCR products were 433 bp (CG1670), 387 bp (CG11218), 335 bp (CG11797) and 393 bp (CG13421).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Isolation of seven classes of taste-tissue cDNAs with similar sequence to insect OBPs
We combined the cDNA subtraction and differential screening methods to identify the genes specifically expressed in taste receptor tissue. Two kinds of taste-tissue cDNA libraries were used: one was the labellar cDNA library and the other was the taste-receptor-rich tissue (=TRRT) cDNA library. The labellum has many taste hairs, but also contains non-taste tissue. To ensure effective screening, we prepared a TRRT and constructed the corresponding cDNA library. Then, cDNA probes were generated for differential screening by subtracting the cDNA of non-taste tissue from that of the taste tissue. This subtraction could enrich the cDNAs expressed in the taste-receptor tissue and would ensure identification of the specific genes at low expression levels.
The labellar cDNA library (20 000 pfu) and the TRRT cDNA library (total 80
000 pfu) were screened with the T — (F + A) or TRRT — Eye probe as
the positive probe and with unsubtracted, non-taste-tissue cDNA (i.e. femur +
antenna cDNA or eye cDNA) as the negative probe. After multiple differential
screenings, 418 cDNA clones hybridized with the positive probe but not with
the negative probe were selected. After sequencing of these clones, seven
classes of cDNAs with significant sequence similarity to insect OBP genes were
identified by a database search with the BLAST program. Most of these clones
had the highest similarity to Drosophila PBPRP genes
(Pikielny et al.,
1994). Based on the taste-tissue-specific expression pattern of
identified genes (see below), we named these gene products `Gustatory
PBP-related proteins (GPBPRPs) 1-7'. The size of the longest clone of each
GPBPRP gene, except the poly(A) tail, was 733 bp (GPBPRP1), 627 bp (GPBPRP2),
831 bp (GPBPRP3), 907 bp (GPBPRP4), 552 bp (GPBPRP5), 555 bp (GPBPRP6) and 529
bp (GPBPRP7). The length of the predicted amino acid sequence of each gene was
144 aa (GPBPRP1), 148 aa (GPBPRP2), 148 aa (GPBPRP3), 127 aa (GPBPRP4), 132 aa
(GPBPRP5), 130 aa (GPBPRP6) and 136 aa (GPBPRP7). In addition, multiple
independent cDNA clones of each GPBPRP were obtained from cDNA libraries and
these sequences were shown to be identical by multiple sequencing (data not
shown).
Figure 2 shows the multiple
sequence alignment of the predicted amino acid sequences of the identified
GPBPRPs and several known fly OBPs. All GPBPRPs have the signal peptide
sequence of secreted protein at the N-terminal, as shown by underlining. This
suggests that GPBPRP was also a secreted protein, produced in supporting cells
and secreted into the sensillum lymph, as with other known OBPs
(Pelosi and Maida, 1995,
Hekmat-Scafe et al.,
1997). All GPBPRPs, except GPBPRP4, have six cysteines: a feature
in common with most insect OBPs (Figure
2a). GPBPRP4 did not contain conserved cysteines and had high
degree of sequence similarity to other type of OBP, OS-D protein of
Drosophila (McKenna et
al., 1994) and ejaculatory bulb protein III (PebIII) of
Drosophila (Dyanov and Dzitoeva,
1995), which also do not have conserved cysteines
(Figure 2b).
|
GPBPRP genes are expressed in taste tissue
Figure 3 shows the result of
the virtual Northern blot analysis of GPBPRP genes. All genes were expressed
in taste tissue (labellum and tarsus). Furthermore, the expression of GPBPRP
genes, except for GPBPRP1 and GPBPRP4, was restricted to these taste tissues:
significant expression in other tissues was not detectable. This pattern of
taste-tissue specificity is novel, since most insect OBPs reported so far are
expressed predominantly in antenna. There were some differences in the
expression pattern of GPBPRP genes in the taste tissue. GPBPRP2, 3 and 5 genes
were expressed more abundantly in tarsus than in labellum, while the
expression level of GPBPRP6 and 7 was higher in labellum than in tarsus and
GPBPRP1 gene was expressed in the taste tissue and antenna at equal levels,
but was not detectable in eye or gut. The expression pattern of GPBPRP1 gene
was similar to that of CRLBP of the blowfly
(Ozaki et al., 1995)
and the PBPRP2 gene of Drosophila
(Pikielny et al.,
1994). The GPBPRP4 gene was expressed in the taste tissue more
abundantly than in other tissues, but there was significant expression in the
antenna and eye also, and a trace was observed in gut.
|
Almost the same results were obtained by RT—PCR analysis of GPBPRP genes (Figure 4a). The expression of some GPBPRPs in antenna was observed when the number of cycles of RT—PCR was increased, as shown for GPBPRP5 and GPBPRP7 in Figure 4a, since the RT—PCR analysis is more sensitive than virtual Northern blot analysis. The expression level of most GPBPRP genes in antenna, however, was significantly lower than that in the taste tissue. The expression of GPBPRP genes is, therefore, highly localized to the taste tissues. The expression of all GPBPRP genes in TRRT was obtained by PCR using TRRT cDNA as a template (Figure 4b).
|
It has been shown that some PBPs of moths are expressed in the adult male
antenna but not in the female antenna, so they are thought to regulate the
response to pheromones (Vogt and
Riddiford, 1981; Pelosi and Maida,
1990,
1995). In the GPBPRPs of the
present study, sex dimorphism in expression level was not observed in the
labellum (Figure 4c).
Furthermore, the expression of some GPBPRPs was observed not only in adult
taste tissue but also in larval tissue. GPBPRP2, 4, 5 and 7 genes were
expressed in the head of the third larva
(Figure 4d), which is known to
contain the gustatory organs (Stocker,
1994).
GPBPRPs represent a new class of OBP
Figure 5 shows the
phylogenetic tree of GPBPRPs and several known insect OBPs. The amino acid
sequences (without signal peptide sequence) were aligned using the Clustal X
program and the neighbor joining tree was constructed with the PHYLIP program
package (V. 3.6a). The OBPs of moths are thought to be classified into at
least three subfamilies: PBP; general odorant-binding protein 1 (=GOBP1); and
GOBP2 (Pelosi and Maida, 1995;
Vogt et al., 1999).
The sequence identities among OBPs in these subfamilies are 60-80% across
several species. Recently, another group of OBPs, named antennal-binding
protein X (ABPX), has been identified
(Krieger et al.,
1996; Robertson et
al., 1999). The amino acid identity among the ABPX group is
60%. GPBPRPs were clearly far from such groups of OBPs of moth.
Furthermore, the feature of GPBPRP was the high degree of diversity in the
same species (B. peregrina). The amino acid sequence identity among
GPBPRPs was small (typically 15-25%) and most appear to fall into the
different groups. Such a high level of diversity within the same species was
also reported for the PBPRPs of Drosophila, which are expressed
mainly in antenna (Pikielny et
al., 1994). GPBPRP3, 5, 6 and 7 are relatively far from the
known Drosophila OBPs and may well belong to novel groups. This
corresponds to the result that these four GPBPRP genes are expressed
predominantly in taste tissues but little in other tissues (Figures
3 and
4a). In addition, the identity
between GPBPRP5 and GPBPRP7 was relatively high (53%) and the two proteins
could be classified in the same group.
|
GPBPRP1 has a relatively high sequence similarity to CRLBP of the blowfly,
Phormia regina (73% identity): CRLBP is the major soluble protein in
the taste sensillum of the blowfly (Ozaki
et al., 1995). The expression level of the GPBPRP1 gene
was also the highest in the labellum among the seven GPBPRP genes (Figures
3 and
4a) and GPBPRP1 is thought to
be a Boettcherisca homolog of CRLBP. The phylogenetic analysis placed
GPBPRP1, GPBPRP2, CRLBP, PBPRP2 and PBPRP5 in the same group (boot-strap value
= 57%). GPBPRP1 of Boettcherisca, CRLBP of Phormia and
PBPRP2 of Drosophila have the same expression pattern. They are all
expressed in labellum, tarsus and antenna
(Pikielny et al.,
1994; Ozaki et al.,
1995).
GPBPRP4 of Boettcherisca has a relatively high sequence similarity
with the PebIII (50% identity) and OS-D (39% identity) proteins of
Drosophila (McKenna et
al., 1994; Dyanov and
Dzitoeva, 1995). These proteins do not contain the six cysteines
always conserved in other fly OBPs. Some proteins with significant sequence
similarity to GPBPRP4 have been reported in other insects
(Nomura et al., 1992;
Maleszka and Stange, 1997;
Robertson et al.,
1999; Bohbot et al.,
1998). The similarity is high across several species in different
orders, such as Diptera, Lepidoptera and Blattaria (40% identity) and
some proteins are expressed not only in antenna but also in other tissues, as
with the GPBPRP4 gene (Nomura et
al., 1992; Maleszka and
Stange, 1997).
GPBPRP-related genes in Drosophila
The GPBPRP sequence information obtained in the present study was used to
perform a homology search with the complete Drosophila genome
sequence (Adams et al.,
2000) and the GPBPRP amino acid sequences (except for GPBPRP4)
were used to search the Drosophila protein database with the BLASTP
program. Predicted gene products scoring >35 were selected. This procedure
produced 13 predicted genes with GPBPRP sequence similarity: CG1670, CG7592,
CG8462, CG11218, CG11748, CG11797, CG12944, CG13421, CG13873, CG13874,
CG15129, CG15457 and G15883. They show a high degree of sequence diversity,
like the GPBPRPs of Boettcherisca and the PBPRPs of
Drosophila. All of these genes had the six conserved cysteines, but
in some of them the signal peptide sequence at the N-terminal could not be
estimated with the SignalP program (data not shown). It is noted that many of
these Drosophila GPBPRP gene homologs are located physically close to
each other on the chromosomes. Genes on the cytogenetic map at positions 56-57
included CG8462 (56E4-5), CG11797 (56E4), CG11218 (56E4-5), CG13421 (57A6-7),
CG13873 (56F1), CG13874 (56F1-2) and CG15129 (56E4). Another gene cluster
involves PBPRP2 gene, CG1670, CG11748 and CG15457 mapped to 19D2. There have
been no reports of such clustering of OBP genes, other than for the very
similar genes OS-F (=PBPRP3 gene) and OS-E
(Hekmat-Scafe et al.,
1997).
Figure 6a shows the phylogenetic tree of the known OBPs of Drosophila, GPBPRPs of Boettcherisca and the GPBPRP homologs of Drosophila containing a recognizable putative signal peptide sequence. GPBPRP5 and GPBPRP7 of Boettcherisca, and the products of CG8462, CG11218 and CG11797 of Drosophila, have relatively high sequence similarity (33-65% identity) and appear to be in same subgroup (Figure 6a). Furthermore, the three Drosophila genes are cytogenetically close, at 56E4-5. We performed RT—PCR analysis to ascertain whether or not these predicted GPBPRP gene homologs are really expressed in taste tissue. Because GPBPRP3, 5, 6 and 7 of Boettcherisca are apparently new OBPs expressed almost exclusively in taste tissue, we selected the predicted genes of Drosophila that were the most similar to these four GPBPRPs. They were CG1670, CG11218, CG11797 and CG13421. Figure 6b shows the RT—PCR analysis of the expression of these four Drosophila GPBPRP gene homologs. As with the GPBPRP genes of Boettcherisca, they were expressed in labellum and tarsus. However, unlike in Boettcherisca, three of the four genes were also expressed in antenna at almost the same level in this preparation. No signal was observed in lane L (labellum) for CG1670 in Figure 6b, but the expression of this gene in the labellum was confirmed by RT—PCR with more cycles (data not shown).
|
Finally, we performed the RT—PCR analysis using the poxn70 mutant. Figure 6c shows the RT—PCR fragments of CG11218, CG11797, CG13421 and RP49. In both labellum and tarsus, each Drosophila GPBPRP gene homolog was expressed almost at a same level in poxn70 /poxn70 fly and poxn70/+ fly.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Novel feature of GPBPRPs in insect OBP genes
Using differential screening, seven GPBPRP genes that have sequence
similarity with known insect OBP genes were identified in the fleshfly B.
peregrina. The special feature of these GPBPRP genes is their predominant
expression in taste tissue. All GPBPRP genes are expressed in labellum and
tarsus, and most of them are scarcely expressed in other (non-taste) tissues,
including antenna, head and gut. Many of the known insect OBPs are expressed
predominantly in the adult antenna. Some OBPs, such as PBPRP2 of
Drosophila and CRLBP of blowfly, are reportedly expressed in both
olfactory and taste tissues (Pikielny
et al., 1994; Ozaki
et al., 1995). In vertebrates, one OBP-related protein,
named von Ebner's gland protein (VEG protein), has been reported to be
secreted in saliva (Schmale et
al., 1990) and tear fluid
(Redl et al., 1992).
However, there are no insect OBPs with a taste-tissue-specific expression
pattern. GPBPRPs, therefore, are considered to comprise a novel type of insect
OBP that function for taste reception.
Boettcherisca GPBPRP genes were expressed in TRRT
(Figure 4b). In most GPBPRP
genes, the number of cycles for PCR using TRRT cDNA was lower than that for
labellar cDNA at the same amplification level. This suggested that GPBPRP
genes in labellum were expressed predominantly in the cells of TRRT. Because
TRRT is presumed to contain only a small number of cells, including receptor
and supporting cells, the expression of GPBPRP may be restricted to some of
these cells. On the other hand, there were almost no differences in the
expression levels of GPBPRP gene homologs between poxn mutant and
control flies in Drosophila
(Figure 6c). Therefore, these
genes were scarcely expressed in the taste receptor cells. There are no taste
receptor cells, but only the supporting cells in the transformed bristle in
labellum and tarsus of poxn70/poxn70 fly. These
results suggested that GPBPRP genes were expressed mainly in the supporting
cells. This suggestion is supported by the observation that
Drosophila OBPs, OS-E and OS-F proteins, are present in the
supporting cells as well as in sensillum lymph
(Hekmat-Scafe et al.,
1997).
The total numbers of chemosensory hairs on one labellum, six tarsi and two
antennae of a fly are, respectively, 300, 1200 in the blowfly
(Dethier, 1976) and 850
in Drosophila (Stocker,
1994). In the fleshfly, the number of chemosensory hairs on the
labellum and tarsus is about equal to that in the blowfly. However, the number
on the antenna is thought to be far fewer in Drosophila. In our
experiments, the amounts of total RNA extracted from one labellum, six tarsi
and two antennae of a fleshfly were 160, 500 and 80 ng, respectively. This
suggests that the ratio of the number of supporting cells (i.e. the candidate
GPBPRP producing cells) to a fixed amount of total RNA sample is at least five
times larger in the antenna than in the taste tissue, based on the assumption
of an equal number of supporting cells per chemosensory hair for labellum,
tarsus and antenna. If the expression level of GPBPRP genes is the same for
each supporting cell, the observed level of GPBPRP gene expression should
therefore be five times higher in antenna than in the taste tissues in virtual
Northern blot and RT—PCR analysis (since the amount of cDNA templates
are equally loaded). However, the results observed clearly show that the
expression level of GPBPRP genes in the taste tissue is higher than that in
antenna. The true expression pattern of GPBPRP genes in the taste tissues may
therefore be much more specific than that observed by virtual Northern blot
analysis (Figure 3) and
RT—PCR analysis (Figure
4a).
Some Drosophila genes with sequence similarity to GPBPRP genes were also expressed in the taste tissue (Figure 6b). However, they were less specific for taste tissue than those of Boettcherisca, since three of the four Drosophila genes were expressed significantly in antenna (Figure 6b). The true expression of the Drosophila GPBPRP gene homologs may still be specific to taste tissue, however, since the relative number of supporting cells to a fixed amount of total RNA sample is expected to be much larger in antenna than in the taste tissue.
Function of GPBPRPs
OBPs are thought to transport hydrophobic molecules such as pheromones or
odorants into the hydrophilic environment surrounding the olfactory receptor
cell and to regulate the olfactory response. Although many insect OBPs have
been identified, there is little direct functional evidence for the
participation of OBPs in chemoreception. Only two fly OBPs, LUSH protein in
Drosophila and CRLBP in Phormia, have been investigated for
their chemoreceptive function. A lush mutant of Drosophila
was identified by the enhancer trapping method and the mutant flies show
abnormal chemoattractive behavior, with enhanced attraction to ethanol and
propanol (Kim et al.,
1998). CRLBP is the main soluble protein in the labellum of the
blowfly and treatment of taste receptor cells with antibody to the CRLBP
reduces the response to taste stimuli containing hydrophobic compounds
(Ozaki et al., 1995).
These reports confirm that these proteins participate in insect
chemoreception.
Because the expression of GPBPRPs is specific to taste tissue, GPBPRPs are
expected to function only in taste reception. Tastants are generally
hydrophilic, but hydrophobic molecules, such as bitter compounds, are also
detected by the taste receptor cell, as shown by behavioral and
electrophysiological studies (Dethier,
1976). Expression patterns that are taste-tissue-specific, lacking
in sexual dimorphism and also detectable in the larval head, suggest important
roles for GPBPRPs in the taste reception of various hydrophobic tastants and
participation in the feeding behavior of the fly throughout the life span from
larva to adult.
There were two types of GPBPRPs expression pattern in the taste tissue: GPBPRP2, 3 and 5 genes were expressed more abundantly in tarsus than in labellum; while levels of GPBPRP6 and 7 in labellum were higher than in tarsus. This difference in expression pattern between labellum and tarsus presumably reflects the different functions of these taste tissues: the tarsus perhaps being more important in detecting food and the labellum more essential in determining food intake.
Fly OBPs and mammalian OBPs
The genes with sequence similarity to GPBPRP genes of
Boettcherisca were found in the predicted gene database of
Drosophila (Figure 6). The number of novel GPBPRP gene homolog candidates of Drosophila was
at least 13. Together with the known OBPs, such as the PBPRPs, the total
number of OBPs in the Drosophila genome is large and estimated to be
at least 21. The sequence similarities of these gene products were very low
(20% amino acid identity) compared with that of PBPs or GOBPs of moth
(60-80% amino acid identity in each subfamily). Furthermore, the PBPRP
genes of Drosophila are expressed in the limited region of antenna
and show different expression patterns from each other. For example, PBPRP1
gene is expressed in the anterior part of the antenna, while PBPRP5 gene is
expressed in a more posterior position
(Pikielny et al.,
1994). In the same manner as PBPRPs of Drosophila, each
GPBPRP of Boettcherisca and GPBPRP homolog of Drosophila may
be expressed differently in various types of taste hair of the labellum and
tarsus. The chemosensory hairs of insects are separated from each other and
the OBPs are secreted discretely in the sensillum lymph of each hair. The
sequence diversity and differential expression pattern of OBPs may contribute
to the specific response of each chemosensory hair, especially since it is
known that some fly OBPs affect the chemosensory response
(Ozaki et al., 1995;
Kim et al.,
1998).
The OBPs of rat and mouse that have been identified are fewer in number and
have a higher level of sequence similarity than fly OBPs
(Pevsner et al.,
1988; Dear et al.,
1991). Mammalian OBP-related proteins are uniformly secreted in
the olfactory mucus (OBPs) or in the saliva (VEG protein) and are not
restricted to the local fluid environment of the chemoreceptor cells.
Mammalian OBPs, therefore, could not be related to specific receptor cells and
their contribution to specific chemosensory responses seems rather unlikely.
Furthermore, functional expression studies of the olfactory receptor genes
strongly suggest that mammalian OBPs are not essential to odor reception,
because the receptor gene alone expressed in a heterologous cell system
without any OBPs was able to respond to odorants
(Raming et al., 1993;
Wellerdieck et al.,
1997; Krautwurst et
al., 1998).
The features of fly OBPs (large number, high sequence diversity and differential expression pattern) suggest that they have functional roles in both general and specialized facets of fly chemoreception, while for mammalian OBPs, their function in chemoreception seems likely to be much less direct, because of their small number, low diversity and uniform distribution compared with fly OBPs.
OBPs and chemosensory receptors
Candidate odorant receptor genes include members of several superfamilies
of large G-protein-coupled receptor (GPCR) gene
(Buck and Axel, 1991;
Dulac and Axel, 1995;
Herrada and Dulac, 1997;
Matsunami and Buck, 1997). The
number of olfactory receptor genes expressed in the main olfactory epithelium
of rodents is estimated to be 1000
(Buck and Axel, 1991).
Recently, a large GPCR gene family has been identified which is suggested to
code the taste receptors for bitter taste in mammals
(Adler et al., 2000;
Matsunami et al.,
2000). The number of these genes was estimated to be 40-80 in
the human genome.
In insects, novel GPCR genes of Drosophila have been cloned
(Clyne et al., 1999;
Gao and Chess, 1999;
Vosshall et al.,
1999). These presumptive odorant receptor genes are expressed in a
small subset of olfactory receptor cells. Only 41 candidate odorant receptor
genes have been identified based on a genomic database analysis
(Vosshall et al.,
2000). Recently, the taste receptor gene candidates of
Drosophila have been reported, which have seven transmembrane domains
with little sequence similarity with the known GPCRs
(Clyne et al., 2000;
Dunipace et al.,
2001; Scott et al.,
2001). The number of these genes is estimated to be only 56. The
number of chemosensory (olfactory and taste) receptors of Drosophila
is, therefore, very small compared with that of mammals.
The number of OBP genes relative to that of chemoreceptor (olfactory and taste) genes in the fly is much larger than in mammals. This relatively large number of OBP genes and their high diversity suggest an important role of OBPs in chemoreception in the fly. With a relatively small number of chemoreceptor genes but a large number of OBP genes, both with diverse sequences, it may be that, after all, flies are almost equal to vertebrates in their ability to respond to various chemical stimulants.
This work was partly reported in abstract form
(Koganezawa and Shimada,
2000). While this paper was being reviewed, a study describing the
expression of a large family of Drosophila OBPs in gustatory and
olfactory sensilla was published (Galindo
and Smith, 2001).
|
Acknowledgments |
|---|
We are grateful to Dr Ken-ichi Kimura for supplying the poxn mutant. This study was partly supported by a grant-in-aid (Integrated Research Program on the Development of Insect Technology) from the Ministry of Agriculture, Forestry and Fisheries (to I.S.), a grant-in-aid from the Ministry of Education, Science and Culture of Japan, and JSPS Research Fellowships for Young Scientists (to M.K.).
|
References |
|---|
|
TopAbstractIntroductionMaterials and methodsResultsDiscussionReferences |
|---|
Adams, M.D., Celniker, S.E., Holt, R.A., et al. (2000) The genomic sequence of Drosophila melanogaster.Science , 287,2185 -2195.
Adler, E., Hoon, M.A., Mueller, K.L., Chandrashekar, J., Ryba, N.J.P. and Zuker, C.S. (2000) A novel family of mammalian taste receptors. Cell,100 , 693-702.[ISI][Medline]
Awasaki, T. and Kimura, K. (1997) pox-nuro is required for development of chemosensory bristles in Drosophila. J. Neurobiol., 32,707 -721.[ISI][Medline]
Bohbot, J., Sobrio, F., Lucas, P. and Nagnan-Le Meillour, P. (1998) Functional characterization of a new class of odorant-binding proteins in the moth Mamestera brassicae. Biochem. Biophys. Res. Commun., 253,489 -494.[ISI][Medline]
Breer, H., Krieger, J. and Raming, K. (1990) A novel class of binding proteins antennae of silkmoth Antheraea pernyi. Insect Biochem.,20 , 735-740.
Buck, L. and Axel, R. (1991) A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell, 65,175 -187.[ISI][Medline]
Chaudhari, N., Landin, A.M. and Roper, S.D. (2000) A metabotropic glutamate receptor variant functions as a taste receptor. Nat. Neurosci.,3 , 113-119.[ISI][Medline]
Clyne, P.J., Warr, C.G., Freeman, M.R., Lessing, D., Kim, J. and Carlson, J.R. (1999) A novel family of divergent seven-transmembrane proteins: candidate odorant receptors in Drosophila.Neuron , 22,327 -338.[ISI][Medline]
Clyne, P.J., Warr, C.G. and Carlson, J.R.
(2000) Candidate taste receptors in Drosophila.Science
, 287,1830
-1834.
Dambly-Chaudiere, C., Jamet, E., Burri, M., Bopp, D., Basler, K., Hafen, E., Dumont, N., Spielmann, P., Ghysen, A. and Noll, M. (1992) The paired box gene pox neuro: a determinant of poly-innervated sense organs in Drosophila. Cell,69 , 159-172.[ISI][Medline]
Dear, T.N., Campbell, K. and Rabbitts, T.H. (1991) Molecular cloning of putative odorant-binding and odorant-metabolizing proteins. Biochemistry,30 , 10376-10382.[Medline]
Dethier, V.G. (1976) The Hungry Fly. Harvard University Press, Cambridge, MA.
Dulac, C. and Axel, R. (1995) A novel family of genes encoding putative pheromone receptors in mammals.Cell , 83,195 -206.[ISI][Medline]
Dunipace, L., Meister, S., McNealy, C. and Amrein H. (2001) Spatially restricted expression of candidate taste receptor in the Drosophila gustatory system. Current Biol., 11,822 -835.[ISI][Medline]
Dyanov, H.M. and Dzitoeva, S.G. (1995) Method for attachment of microscopic preparations on glass for in situ hybridization, PRINS and in situ PCR studies.Biotechniques , 18,822 -826.[ISI][Medline]
Galindo, K. and Smith, D.P. (2001) A
large family of divergent Drosophila odorant-binding proteins
expressed in gustatory and olfactory sensilla. Genetics,159
, 1059-1072.
Gao, Q. and Chess, A. (1999) Identification of candidate Drosophila olfactory receptors from genomic DNA sequence. Genomics, 15,31 -39.
Gyorgyi, T.K., Roby-Shemkovitz, A.J. and Lerner, M.R.
(1988) Characterization and cDNA cloning of pheromone-binding
protein from the tobacco hornworm, Manduca sexta: a tissue-specific
developmentally regulated protein. Proc. Natl. Acad. Sci.
USA, 85,9851
-9855.
Hansen, K. (1978) Insect chemoreception. In Hazelbauer G.L. (ed.), Taxis and Behavior. Chapman & Hall, London, pp.233 -292.
Hekmat-Scafe, D.S., Steinbrecht, R.A. and Carlson,
J.R. (1997) Coexpression of two odorant-binding protein
homologs in Drosophila: implication for olfactory coding.J. Neurosci.
, 17,1616
-1624.
Herrada, G. and Dulac, C. (1997) A novel family of putative pheromone receptors in mammals with a topographically organized and sexually dimorphic distribution. Cell,90 , 763-773.[ISI][Medline]
Hoon, M.A., Adler, E., Lindemeier, J., Battey, J.F., Ryba, N.J.P. and Zuker, C.S. (1999) Putative mammalian taste receptors: a class of taste-specific GPCRs with distinct topographic selectivity. Cell, 96,541 -551.[ISI][Medline]
Kim, M., Repp, A. and Smith, D.P. (1998)
LUSH odorant-binding protein mediates chemosensory responses to alcohols
in Drosophila melanogaster. Genetics,150
, 711-721.
Koganezawa, M. and Shimada, I. (2000) Cloning of pheromone-binding protein-related protein genes in taste tissue of fleshfly. In Persaud, K.C. and Van Toller, S. (eds), 13th International Symposium on Olfaction and Taste (ISOT 2000), p.135 (abstract).
Krautwurst, D., Yau, K. and Reed, R.R. (1998) Identification of ligands for olfactory receptors by functional expression of a receptor library. Cell,95 , 917-926.[ISI][Medline]
Krieger, J., Raming, K. and Breer, H. (1991) Cloning of genomic and complementary DNA encoding insect pheromone binding proteins: evidence for microdiversity.Biochem. Biophys. Acta , 1088,277 -284.[Medline]
Krieger, J., Ganssle, H., Raming, K. and Breer, H. (1993) Odorant binding proteins of Heliothis virescens.Insect Biochem. Mol. Biol. , 23,449 -456.[ISI][Medline]
Krieger, J., von Nickisch-Rosengk, E., Mameli, M., Pelosi, P. and Breer, H. (1996) Binding proteins from the antennae of Bombyx mori. Insect Biochem. Mol. Biol.,26 , 297-307.[ISI][Medline]
McKenna, M.P., Hekmat-Scafe, D.S., Gaines, P. and
Carlson, J.R. (1994) Putative Drosophila
pheromone-binding proteins expresses in a subregion of olfactory
system. J. Biol. Chem., 269,16340
-16347.
McLaughlin, S.K., McKinnon, P.J. and Margolskee, F. (1992) Gustducin is a taste-cell-specific G protein closely related to the transductions. Nature,357 , 563-569.[Medline]
Maleszka, R. and Stange, G. (1997) Molecular cloning, by a novel approach, of a cDNA encoding a putative olfactory protein in the labial palps of moth Cactoblastis cactorum.Gene , 202,39 -43.[ISI][Medline]
Mameli, M. (1997) Unpublished sequences, accession No. CAA05509.
Mameli, M., Kreiger, J. and Breer, H. (1997) Unpublished sequences, EMBL accession No. Y10970.
Matsunami, H. and Buck, L.B. (1997) A multigene family encoding a diverse array of putative pheromone receptors in mammals. Cell, 90,775 -784.[ISI][Medline]
Matsunami, H., Montmayeur, J.-P. and Buck, L.B. (2000) A family of candidate taste receptor s in human and mouse. Nature, 404,601 -604.[Medline]
Morita, H. (1992) Transduction process and impulse initiation in insect contact chemoreceptor. Zool. Sci., 9,1 -16.
Morita, H. and Shiraishi, A. (1985) Chemoreception physiology. In Kerkut, G.A. and Gilbert, L.I. (eds),Comprehensive Insect Physiology, Biochemistry and Pharmacology . Pergamon Press, Oxford, pp. 133-170.
Nomura, A., Kawasaki, K., Kubo, T. and Natori, S. (1992) Purification and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach). Int. J. Devl Biol.,36 , 391-398.
Nottebohm, E., Usui, A., Therianos, S., Kimura, K., Dambly-Chaudiere, C. and Ghysen, A. (1994) The gene poxn control different steps of formation of chemosensory organs in Drosophila. Neuron, 12,25 -34.[ISI][Medline]
Ozaki, M., Morisaki, K., Idei, W., Ozaki, K. and Tokunaga, F. (1995) A putative lipophilic stimulant carrier protein commonly found in the taste and olfactory systems. A unique member of the pheromone-binding protein superfamily. Eur. J. Biochem., 230,298 -308.[ISI][Medline]
Pelosi, P. (1996) Perireceptor events in olfaction. J. Neurobiol., 30,3 -19.[ISI][Medline]
Pelosi, P. and Maida, M. (1990)
Odorant-binding proteins in vertebrates and insects: similarities and
possible common function. Chem. Senses,15
, 205-215.
Pelosi, P. and Maida, M. (1995) Odorant-binding proteins in insects. Comp. Biochem. Physiol. B, 111,503 -514.[Medline]
Pelosi, P., Baldaccini, N.E. and Pisanelli, A.M. (1982) Identification of specific olfactory receptor for 2-isobutyl-3-methoxypyrazine. Biochem. J.,201 , 245-248.[ISI][Medline]
Pevsner, J., Reed, R.R., Feinstein, P.G. and Snyder,
S.H. (1988) Molecular cloning of odorant-binding protein:
member of ligand carrier family. Science,241
, 336-339.
Pikielny, C.W., Hasan, G., Rouyer, F. and Rosbash, M. (1994) Members of family of Drosophila putative odorant-binding proteins are expressed in different subsets of olfactory hairs. Neuron, 12,35 -49.[ISI][Medline]
Raming, K., Krieger, J. and Breer, H. (1989) Molecular cloning of an insect pheromone-binding protein. FEBS Lett., 256,215 -218.[ISI][Medline]
Raming, K., Krieger, J. and Breer, H. (1990) Primary structure of a pheromone-binding protein from Antheraea pernyi: homologies with other ligand-carrying proteins. J. Comp. Physiol. B, 160,503 -509.[Medline]
Raming, K., Krieger, J., Strotmann, J., Boekhof, I., Kubick, S., Baumstark, C. and Breer, H. (1993) Cloning and expression of odorant receptors. Nature,361 , 353-356.[Medline]
Redl, B., Holzfeind, P. and Lottspeich, F.
(1992) cDNA cloning and sequencing reveals human tear
prealbumin to be a member of the lipophilic-ligand carrier protein
superfamily. J. Biol. Chem., 267,20282
-20287.
Robertson, H.M., Martos, R., Sears, C.R., Todres, E.Z., Walden, K.K. and Nardi, J.B. (1999) Diversity of odourant binding proteins revealed by an expressed sequence tag project on male Manduca sexta moth antennae. Insect Mol. Biol.,8 , 501-518.[ISI][Medline]
Schmale, H., Holtgreve-Grez, H. and Christiansen, H. (1990) Possible role for salivary gland protein in taste reception indicated by homology to lipophilic-ligand carrier proteins.Nature , 343,366 -369.[Medline]
Scott, K., Brady, R., Jr, Cravchik, A., Morozov, P., Rzhetsky, A., Zuker, C. and Axel, R. (2001) A chemosensory gene family encoding candidate gustatory and olfactory receptors in Drosophila. Cell, 104,661 -673.[ISI][Medline]
Stocker, R.F. (1994) The organization of chemosensory system in Drosophila melanogaster: a review.Cell Tissue Res. , 275,3 -26.[ISI][Medline]
Ugawa, S., Minami, Y., Guo, W., Saishin, Y., Taketsuji, K., Yamamoto, T., Tohyama, M. and Shimada, S. (1998) Receptor that leaves a sour taste in mouth. Nature,395 , 555-556.[Medline]
Vogt, R.G. and Riddiford, L.M. (1981) Pheromone binding and inactivation by moth antennae.Nature , 293,161 -163.[ISI]
Vogt, R.G., Rybczynski, R. and Lerner, M.R. (1991) Molecular cloning and sequencing of general odorant-binding proteins GOBP1 and GOBP2 from the tobacco hawk moth Manduca sexta: comparisons with other insect OBPs and their signal peptides. J. Neurosci., 11,2972 -2984.[Abstract]
Vogt, R.G., Callahan, F.E., Rogers, M.E. and Dickens,
J.C. (1999) Odorant binding protein diversity and
distribution among the insect orders, as indicated by LAP, an OBP-related
protein of the true bug Lygus lineolaris. Chem. Senses,24
, 481-495.
Vosshall, L.B., Amerein, H., Morozov, P.S., Rzhetsky, A. and Axel, R. (1999) A spatial map of olfactory receptor expression in the Drosophila antenna. Cell,96 , 725-736.[ISI][Medline]
Vosshall, L.B., Wong, A.M. and Axel, R. (2000) An olfactory sensory map in fly brain.Cell , 102,147 -159.[ISI][Medline]
Wellerdieck, Ch., Oles, M., Pott, L., Korsching, S., Gisselmann,
G. and Hatt, H. (1997) Functional expression of
odorant receptors of the zebrafish Danio rerio and of the
nematode C. elegans in HEK293 cells. Chem.
Senses, 22,467
-476.
Accepted December 28, 2001
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||